Home
Doug's Journal
 
[Most Recent Entries] [Calendar View] [Friends]

Below are the 20 most recent journal entries recorded in Doug's LiveJournal:

    [ << Previous 20 ]
    Thursday, August 6th, 2009
    11:30 am
    I think I'm at risk of becomming the least interesting person I know.
    Wednesday, July 15th, 2009
    7:29 pm
    I'm annoyed with my life
    Day 2304083243 of looking for a job... still nothing. I'm thinking about doing this teach kids to read program through the AmeriCorps, but I'm not sure what kinds of schools they'd send me to. Not only that, but its $7200 for a year of work. It might be something good to get me through grad school though.

    My Mom made reservations for everyone in the family, including me, at rooms in Las Vegas. She got them all at discounted rates for blowing so much money there. It should be fun, except for the fact that I'm not comfortable driving my 16 year old car all the way to Vegas and back. Not only that, but I'm going to have to learn to vacation very cheaply.
    Wednesday, June 24th, 2009
    7:15 pm
    The Job Hunt
    I got a nice email from the state today. I've been approved by the state for a preliminary teaching credential. All of this work, and its only preliminary. I have to teach for two years before it is actually official. The problem is that there aren't really any jobs anywhere.

    Its been difficult going from working my ass off at 100 mph to 0, doing nothing. Everyday I invent a new project that needs to be done in order to stay busy.

    I've been searching the internets, looking for anything to do. I always thought I'd have retail as a back-up plan, since I did it for 12 years, but even that isn't working to my advantage. Its probably time to pound some pavement to find a job, but I don't even know where to begin since anywhere that I'd have to walk in to apply is a job that I probably don't want.

    I think if I were to go back to retail, I'd want it to be someplace like a petstore where I get to look at cute baby animals all day or something. Or, maybe some mom and pop owned place that is low key. At this point I'm not even sure I care what I do, as long as its something a few hours a week. With that being said, I think I should watch what I wish for.

    I was accepted in to the MA History program at Cal Poly for the Fall quarter, so I just need to make it to September before I have a goal again.
    Wednesday, June 17th, 2009
    11:25 am
    What's the difference?
    What's the difference between contentment and boredom?
    Thursday, June 11th, 2009
    11:17 am
    Matt & Kim
    Has anyone heard of a band called Matt and Kim? What do you think about them? I heard a song by them on a Bacardi commercial and I downloaded it, and really like it. I'm wondering about downloading other songs by them.
    Tuesday, June 9th, 2009
    7:43 pm
    Dear Livejournal,
    You've changed since the last time I've visited.

    I know I've been neglecting you as of late, but I think we'll be seeing a lot more of each other very soon as I'm one paper shy of finishing the teaching credential program and I'm unemployed.

    Are any of my friends still on here? Why is it that I can't go back very far to read my friends' old journal entries?

    Doug
    Wednesday, December 17th, 2008
    12:55 am
    I need to...
    I need to write on here more. I remember enjoying it, and its not as public as facebook or myspace.
    Wednesday, May 28th, 2008
    4:41 pm
    It's funny how I had a few weeks where I was finally feeling alright. I thought I had finally adjusted to living at home again until I received a call saying that I wasn't needed as a substitute teacher anymore. Now I'm wondering what I'm going to do for an income over the Summer. It has to be a temporary job because I start student teaching again in the Fall. Blah.
    Saturday, May 17th, 2008
    6:33 am
    Ten Years
    I'm graduating from college today. It's about time.
    Sunday, January 27th, 2008
    11:30 pm
    The End of an Era
    It’s the end of an era. I say this for more than one reason. The main reason is that my Grandpa died last night. I have no more Grandpas. I spent time with him a year and a half ago when he shot himself in the head. It was probably one of the most stressful times of my life. However, after going through a situation with someone like that, you kind of get an emotional bond. While I hadn’t been back to Florida to visit him, we talked on the phone on each holiday and he enjoyed hearing from me just because he was surrounded by women that nagged him. He enjoyed the fact that I recognized this.
    The shotgun incident happened during one of the worst summers in my life. It seems like my 20s have been filled with turbulent times though. I had packed my bags and moved to Georgia for a relationship that went wrong. It was pretty scary living in a place and not having anywhere to go to. It’s scary being stuck with no help. I came home to a house that had been torn apart because every wall had black mold in it. I had had enough and I decided to move to Southern California to get away from things for awhile. I think that was a good decision but I don’t think I ever really dealt with my issues. I packed them in to a little box in the back of my head and kept myself so busy that I didn’t have to think about them. This idea wasn’t intentional, but it worked. I had a great time in Southern California and made lots of friends. I’m back in SLO County though, and things seem to be coming back to the surface.
    One thing that I realized about my life is that if it’s a mess, I’ll attract a mess. I haven’t had a normal date in a year and a half. Justin was probably the closest I came to that, but he seemed to enjoy causing problems. At the point in which I met him, my life was kind of like a dirty kitchen. When your kitchen is dirty, you don’t mind adding extra mess to the pile. Why not throw an extra dirty plate on the pile? I was the dirty kitchen, and Justin was more mess. I just need to make my life more like a clean kitchen that you think twice about leaving a spaghetti sauce covered plate laying around in.
    The other reason I think it’s the end of an era is because my birds died last week. My parents got a new dog to replace the one that died the day before Thanksgiving, and the new dog tried to eat my birds. They stuck the birds in the storage shed in the back yard to keep them away from the dog but they ended up freezing to death because of the cold weather we’ve been having. These birds are the birds that I got in 2005 right before I quit my job and went back to school. I got them when Jeromy moved out of the apartment because it was too quiet living by myself. Shortly after that they started having a ton of babies. They’re all dead now.
    Within the matter of a month, I finally graduated from college, started grad school, lost my grandpa, and my pet birds. It seems as if life is telling me it’s time to get rid of the old baggage and start new. As depressing as this sounds, it seems as if there might be light at the end of the tunnel. I’m just really sad that I lost my grandpa and that I couldn’t be there for him.
    Tuesday, August 21st, 2007
    11:57 pm
    stuff
    In 15 weeks, I will be a college graduate. I still don't know what I'm going to do after that. I'm looking at teaching credential programs now. CSUN doesn't care about it's students. Pepperdine costs $800 a unit, Cal Lutheren costs $500 but both give a MA in education at the same time as a credential. Cal Poly hasn't updated their site in years.

    I've been totally infatuated with this guy who I've been chatting with on connexion.org. He works at the LA zoo and I think that's kinda hot. He invited me to meet him at the zoo on Thursday night and I hope he doesn't flake. If anything, I'll get to see the zoo.

    Yesterday Morgan and I drove down to the Santa Monica pier. I love Southern California weather and the beaches. I like watching all of the pretty, stuck up people walk by. I've also developed a fondness for palm trees. They seem like the represent the good life. You only see palm trees when things are good, like when you're sitting on the beach in Mexico and drinking a margarita.

    I'm hungry.

    Current Mood: amused
    Saturday, March 31st, 2007
    6:23 pm
    hello again.
    This morning my manager sat me down and asked me what I'm going to do when I graduate. I still don't know. I'm not a big fan of Southern California, and after a visit from my parents last weekend, I don't really want to go back to the Central Coast either. I'm thinking about going to grad school just so I don't have to make a decision as to what I'm doing yet. However, with that decision would come the decision on where to go to grad school and how I'd survive another two years without a decent income.

    Someone tell me what to do!
    Friday, March 23rd, 2007
    3:03 pm
    Spring Break 2007
    I think this is the worst Spring Break in history. It's involved having a camera shoved through my nose to my throat, a lot of cleaning and laundry, and today I topped it off with doing my taxes and filling out my FAFSA. This is all stuff that really needed to get done, and it was good having a chance to catch my breath, but I kinda wish I had had more fun. I think I have more fun during normal life than I have this week. Something that was kind of interesting about the financial aid paperwork is that last year it said my expected contribution was $25,000. This year it's $0. I don't really know what that is going to mean for me in this upcoming year.
    Friday, March 16th, 2007
    7:56 am
    Time is going by so fast
    This week was already midterms which means the semester is already half over. That means I just have a semester and a half left until I graduate. At this point I don't know what I'm going to do. I'm beginning to think that moving back to SLO and getting my teaching credential at Cal Poly is the only reasonable option. I hate it there though.
    Tuesday, March 6th, 2007
    12:42 pm
    Hi
    I'm sitting in the library right now, waiting for my 1pm class to start. I've been working on a 7 page paper on the causes of World War 1 since my last class got out at 9:45. My brain is fried and I only have two pages written. I'm writing it for a professor who cares more about the writing aspect of the paper than the history portion so I'm sure it'll be torn apart given that writing isn't what I'm best at. I'm really hungry but I can't stand the thought of eating in the dining commons. The only thing desent there is the pizza and even that leaves something to be desired.

    I have this week and then next week before I get a week off for spring break. I have 6 research papers due next week along with an oral presentation about a historian and his historical theory. I think I hate history now.
    Thursday, January 18th, 2007
    6:27 pm
    Just stuff
    It's been really cold here for a couple weeks and actually snowed. I feel like I'm getting ripped off of my southern california weather experience because, if you think about it, the weather is one of the few things this place has going for it.

    I start school on Monday. I'm terrified. Last semester was one of the most stressful times of my life and I'm going to do it again for another 15 weeks. I ended last semester with a 3.54. I would've had a 3.6 but this school uses the plus/minus system and actually counts it towards your g.p.a. My overall g.p.a. is 3.3 something or another which isn't half bad considering my grades from Cal State Monterey Bay consisted of an A, an F, two no credits and an incomplete. The school is actually counting those towards my g.p.a. as well. I'm on track to graduate in December and don't know what I'm doing yet.

    I like my job for the most part. Business has really slowed down, which is nice. We sold one of our $3200 espresso machines the other day. It's weird watching people drop the amount of money they do at Sur La Table. It was actually this customers second machine. He was buying a new one for his other house in Hawaii.

    That's it for now.
    Thursday, December 21st, 2006
    2:53 am
    Wherever you go, there you are.
    It’s that time when people have a tendency to take stock of what’s happened to them over the last year. It’s weird when you think about it because, really, there is no difference between December 31st and January 1st. It’s really just one month changing to another. When July changes to August no one makes a big deal of that. I keep seeing all of these bulletins posted on myspace where various people have filled out surveys examining their lives in 2006. I started to fill one out myself when I realized I didn’t want to.

    It was when I started filling out this survey that I realized how chaotic my life has been in 2006. I rang in the New Year in San Francisco this year. The sun was coming up by the time I began to make my way back to the hotel in which Frank, Jason, and I stayed. It was probably one of the most fun nights of my life but I had no idea what was in store for me in the coming year. I should’ve figured that out when, a week later, I was in the emergency room with two kidney stones wanting to come out of me. That was the most physically painful thing I’ve ever had to endure. I wouldn’t recommend it to my friends.

    I think I’ve handled this year fairly well given everything that’s happened. I adjusted to living with my parents and then to the on-going construction that took place shortly after. I had a 3 ½ week stint at Starbucks that was interesting, to say the least. I took a risk and had a relationship not turn out as I thought it would. My grandpa ended up in the hospital. And, I moved (yet again) and adjusted to a new school.

    When I went home for Thanksgiving, my sister had everyone in my family trace our hands on to construction paper, cut out the hands, and then write something we were thankful for on both sides of each of the fingers. This was something new for my family since we are more of a get-drunk together type of people rather than a touchy-feely-share our feelings type of family. Among the items listed on my cut out hand’s fingers were alcohol and cheesecake. However, the activity got me thinking just how lucky I am.

    I am thankful for my family and friends that support me even when I take risks. They are always there for me, even when I’m stupid. I am thankful for my ability to make friends easily since they are the people that have made my life so much more pleasant to live. Chris posted a blog on his livejournal that I'm not sure he knows I read, but it was really something I was in need of hearing at that particular moment. Believe it or not, I’m thankful that I got to go to Georgia over the summer. I met people who showed me that not everyone in the world are like those in the corporate dog-eat-dog world that I came from. I’m thankful that I quit my higher paying job with Borders and that I’ve gotten to experience the world. And, I’m thankful that I’m getting this second attempt to finish my education. I found a good roommate and have met some cool people who’ve made the process easier. I should be done this time next year and writing about what new thing I’ve decided to do with my life by then.

    So, this year has been like Mr. Toad’s Wild Ride for me and I just wish that I could show gratification towards everyone who has hung in there with me. While I’m sure Christmas will be interesting when we all get together with our families and deal with them with whatever coping mechanisms we have, I hope everyone has some good holidays. Have a cocktail for me. It’s what I’ll be doing with my family while I wonder what’s in store for next year.
    Monday, December 18th, 2006
    12:46 am
    I think I'm turning blackanese.
    I think I'm turning blackanese. You couldn't tell, could you? I'm so white that I'm borderline albino, but my DNA says otherwise.

    This semester in my Migrations in World History class, one of the things we did was have our DNA analyzed. At the beginning of the semester we had to scrape cells from the insides of our mouths and mail our samples to a lab. I don't want to bore people with the details of how this was figured out, but it turns out that my DNA was in Africa and Asia before it moved to Europe to become the cracker that I am today.

    Here is what I recived back:

    My Mom's DNA is this first map. Her DNA left Africa 150,000 years ago. It turns out that people with this DNA type were really good at developing agriculture, but not so good at reproducing. Very few people have this DNA and no one knows why. I've decided that this must be where my gay genes come from. It's interesting because that side of my family is English.

    Image Hosting by PictureTrail.com

    These are apprently the letters that represent this DNA...ATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGTA
    CCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATT
    ACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTGACCACCTG
    TAGTACATAAAAACCCAACCCACATCAAAACCCCCTCCCCATGCTTACAAG
    CAAGTACAGCAATCAACCCTCAACTATCACACATCAACTGCAACTCCAAAG
    CCACCCCTCACCCACTAGGATACCAACAAACCTACCCATCCTTAACAGCAC
    ATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTT
    CTCGTCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGACCACCATCC
    TCCGTGAAATCAATATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCC
    CATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTA
    CTTCAGGGCCATAAAGCCTAAATAGCCCACACGTTCCCCTTAAATAAGACA
    TCACAATG



    My Dad's DNA is next. Ninety percent of the population of Spain and Ireland have this DNA, which is odd considering his side of the family is German. Somewhere along the line someone slept with a non-German. His family decided to hang out in Africa longer than my Mom's. They said until somewhere between 31,000 and 79,000 years ago. Then they decided to go to Asia before going to Europe and also becoming white crackers with no rhythm as well.

    Image Hosting by PictureTrail.com

    I don't feel like posting the billions of letters for this DNA. It's boring.

    In the end, everyone learned that there is no such thing as race and that we're all related. Leave it to me to come up with my own semi-racist commentary. It was a really interesting project We all have a little bit of blackness in us. I'm just left wondering why I can't dance better.
    Friday, December 1st, 2006
    9:52 am
    I have a very interesting school. Other than being in a building formerly used as a mental institution and being used on the Eagles' "Hotel California" album cover art, they have us do weird things.

    Here is my 3 foot stack of books. Each class had 3 to 5 books, which meant I was supposed to read a book and a half every week on average. The sad thing is that I've actually used all of these books at some point and read most of them. (I thought I'd throw in this picture for the hell of it since people don't seem to understand how busy I am. Also, my little sticker visitor's pass for my teaching observation class at Hueneme High is at the bottom of the picture. I had to wear that every Thursday)

    Image Hosting by PictureTrail.com

    Two examples of how this school is kind of odd are the projects that we have to do. I'm taking a history class called, "The History of Chicana/o art in Southern California." The first quarter we had to translate hyroglyphs. This quarter we had to visit the Los Angeles County Museum of Art and go to the ghetto to take pictures of murals. Ashley and I decided to combine the two trips in to one. Here is a photo montage of how our Wednesday was spent.

    Ashley and I drove down the 101 to the 405 to get to LACMA. On the way, we passed Little Ethiopia. Who knew that existed?

    Image Hosting by PictureTrail.com

    Then we got to LACMA.

    Image Hosting by PictureTrail.com

    But LACMA for some reason was closed on Wednesdays. So, we went to the La Brea Tarpits next door instead looking for some form of Chicano Art. We went out on a limb hoping they would have Chicano Art, and the people inside were really nice about it, but I think they thought we were retards. This is Ashley and me outside the tarpits museum.

    Image Hosting by PictureTrail.com

    This is a picture of Tarpits that animals and people got trapped in and died so that we could discover their remains today :-) Seriously, if you got trapped in them, you deserved to die since they smell so bad. That just proves Darwin's theory true.

    Image Hosting by PictureTrail.com

    So at this point, in a panic trying to get our paper written by that night, we decide that we will just see what art was available for viewing online. After all, it wasn't our fault LACMA was closed. We got the required parking pass and took our picture in front of the building to prove that we went and then moved on to the ghetto.

    To get to the ghetto, first we had to drive through Koreatown.

    Image Hosting by PictureTrail.com

    Then we drove through downtown.

    Image Hosting by PictureTrail.com

    Then we got lost in the garmet district but I was too busy looking at the map to take pictures. It was really amazing and I'd never seen so many cheap, knock-off brand clothes for sale in one place before.

    Finally we made it to the projects.

    Image Hosting by PictureTrail.com

    These projects were build by the city of Los Angeles in the '60s and now have murals and graffiti all over them. Notice the manicured lawns? The projects are surprisingly well kept. These are our tax dollars at work. I didn't feel in danger walking around at all. People did look and me and Ashely kind of wierd though.

    Image Hosting by PictureTrail.com

    I decided to do my project for the art class on this mural about the two olympic slayings.

    Image Hosting by PictureTrail.com

    And here's a close up of the grafitti where someone wrote the word "chunky" for some reason.

    Image Hosting by PictureTrail.com

    So Ashley and I escaped without getting shot. We then went home, drove through the FANCY Taco Bell drive-thru, and wrote our papers.

    I hope you enjoyed my photo montage.

    The End.
    Wednesday, November 15th, 2006
    2:32 pm
    Grad School
    Does anyone know anything about grad schools? I don't really care where I go as long as it's cheap. I typed "cheap tuition" in to google and found an article from acouple years ago saying that Arizona State actually has some of the cheapest tuition in the country. I know paying out of state tuition in Georgia is still cheaper than paying in-state tuition in California. It's a thought but it's a little far away.

    I don't know anything about grad schools but I have to apply for gradation in January and I'm not sure what I'll do after that. I called the counciling department at school and they told me to just walk in to talk to someone.

    It's funny that I don't know anyone who's gone to grad school. I wonder if that says anything about my socio-economic position in life.
[ << Previous 20 ]
My Website   About LiveJournal.com

Advertisement